allmonthweektoday populardaterelevant 1 ULTRA BOY x BLASTA DUBZ - MAC 11 [ UB VIP ] ULTRA BOY [FL Studio] uncategorized riddim. wonkzubbd 0:01:34 12 64 2017-02-05 Favorite Share Remix 2 I'm Hooked 7rixus 1 Bass Music edmvocalstrap 0:02:32 36 810 2024-04-10 Favorite Share Remix 3 WOOOOOOOOOOOO! PT DOS JAYDOG202 uncategorized 0:00:18 1 27 2015-05-07 Favorite Share Remix 4 IAM9 & Almate-200 Followers Super Real Ghost uncategorized wooooooalmate200stuff 0:04:32 12 83 2015-05-28 Favorite Share Remix 5 Our God is an Awesome God (Remix) CallyKay uncategorized all powerfulawesomemercifulholygodwonderfulamazing 0:03:05 313 11819 2013-06-16 Favorite Share Remix 6 Dream World SYNTH REMIX GURRRRRRETT uncategorized woooooo 0:00:55 1 66 2017-07-02 Favorite Share Remix 7 Ambient/Creepy =ASU♥KAT - ゴージャス! uncategorized creepyandstuffyeahaaad 0:02:21 1 145 2011-05-03 Favorite Share Remix 8 Murder she Cried ∆STRØ uncategorized housebassdrop 0:02:41 1 13 2013-11-03 Favorite Share Remix 9 Tenacious CallyKay uncategorized chicken<3dance=drocker-ishoptimisticgrinnclubfun 0:04:44 54 523 2014-02-18 Favorite Share Remix 10 Down Low 7rixus Newbie dubstepeeriecreepybasswobblewip 0:02:27 3 28 2023-08-28 Favorite Share Remix 11 Black waving walls falling. A night. Sharrjin uncategorized machinistela la latimpaniscaryambientnighttamoburineviolinstrangepulverisateurcalmmelodicheisenbergclassical 0:03:35 2 495 2012-12-07 Favorite Share Remix 12 Breathe (Jetdarc's Remix Comp entry) rey Experimental thing 0:05:25 19 208 2019-01-19 Favorite Share Remix 13 Fire (Aringreys barfed up entry) Aringrey uncategorized compfirebcpbenflameredremix 0:02:00 4 50 2016-01-28 Favorite Share Remix 14 [Electro] Panda Eyes - Fuck Off (remix) XculE 6 uncategorized electro 0:04:28 25 403 2016-01-06 Favorite Share Remix 15 Transcendence (ft. Infectzion) Prismanemm28RRinfectzionwco_teria Bass Music riddimdeathstepinfec still has it 0:03:18 17 67 2020-03-28 Favorite Share 16 VECTOR {CLIP} jg uncategorized infektrimmimstepdubribbimrissimwoooooooooiinkfunk.hinutsackriwwimnowkywenk.winkwonskypiudustbagriccimrikkimbudsteprittimzorkwankzoinkedrixximyourmomdeathstepsiuurippimdutbagtechnohouserirrimzoink 0:02:24 8 106 2017-04-05 Favorite Share 17 Pressure Compression reina de las hamburguesas uncategorized 0:00:32 4 98 2016-05-29 Favorite Share Remix 18 Werewolf's Curse ( Max Remix ) ^Max^Ztreet^ ded (KINDA) uncategorized dubstep? 0:03:48 3 38 2015-11-12 Favorite Share Remix 19 Hardcored it Aringrey Hardcore happy hardcore 0:02:51 6 153 2016-08-07 Favorite Share Remix 20 1st kevin_osmond_ Synthwave calm 0:00:32 1 6 2021-10-26 Favorite Share Remix 21 DARK FOREST SCEPTR3 Bass Music dubstephardscaryriddimatmospheredark 0:02:51 1 20 2022-08-20 Favorite Share Remix 22 Moving Forward feat.NOVA and Trevor Whatevr) LoudSystemtrevor whatevrBV3S! (Official) uncategorized drumstepforwardmoving forwardmovingdnb 0:05:38 3 24 2015-06-15 Favorite Share Remix 23 Audiotool Day 2015 - fencingparry4 fencingparry4 uncategorized 0:02:54 2 111 2015-11-11 Favorite Share Remix 24 i am drained of my creative drive ImThing2 (Archive) Newbie who knowstags more tagsweirdhhhlllllllllllllllllllasdasdasdsadasdasasdas5654653465346ooohmyooooggdjjjjgdggdgdgdgdgd45774567bbbbbbbtaggyoddaaaaaaaaaaaaaaasssasdsdawhy can i add so many tambmbmbmbmbmbmbmbmbmbmbmmllllllllllllllllllllllllastassadsadasdas4234234234tags ahahahhajjjjjjjjjjjj647654645dasdasdsdsadasoooooooooooooooooooooooo434234234234ddddsdsadasdasdasdasdasd8658564865eeeeeeeeerrrrrrrrrrrrrwowowowowowowoaasdsadasdasdasdasdgdgdgdgdgdg7456567notjazzylolwhatwwwwwwwwwwwwwwwwwwwwwwwwquixotic7234437430734407agagagagagagagagachinachinaasdasdasdasdasdsdsaddad24324234fine china74357345734573457lmslmslsmslmslsmmemememeememeoemoemeomeofearfulno motiavationjjjjjjjmvmvmvmvmvmvmvmvmvaaaaaaaaaaaaaaaaaaaaaaaahghghghghghghghhdasdasvvvvvvvvvv752734737sadsadsadasdgaragechinaddddno driveasdaqweqweqweqweqweqweqw7432534asdasdasdasd946659645asdtags spam is funasddsadasdasddasdwooooooooooowooooooooooopoqwpoqwpo123129392183123729837219depressednbbnbnbnbnnbasddddddddddddddddddddddddddddddbmmbbmbmgbbggbbqweqweqweqwewqeqwe32423432423dddddsasdsadasdasdasdasd1337jjjtagtagtgatgagtagtagtgatg95043954850247pepepepepepepesadoveroveverjajajajajajajajpqoqoqoqooqoqoqqlqlqlqlqlooooosadsdsadasdsadasdtaggtagtatgoh ym god help me2454353442342ferfwefrwefrmotittiitti435234137049837308138923tagtagtatgatg 0:00:30 2 22 2021-09-25 Favorite Share Remix 25 GlitterForceMusicalEpisode2:Rascal's Revenge ScarletDemonPrincess uncategorized glitterforceissoawesome! 0:04:42 1 16 2016-09-16 Favorite Share Remix 26 MULTIPLE PEOPLE TYPE BEAT Lil DJ uncategorized 21savagemigoslil uzi vert 0:03:24 1 55 2017-07-12 Favorite Share Remix 27 Our God is an Awesome God William Goulet uncategorized 0:03:05 1 92 2013-06-19 Favorite Share Remix 28 Our God is an Awesome God (Remix) DJ ALEXCASAS uncategorized all powerfulawesomemercifulholygodwonderfulamazing 0:03:05 1 113 2015-10-03 Favorite Share Remix 29 Our God is an Awesome God ( trap Remix ) Dab Daddy uncategorized all powerfulawesomemercifulholygodwonderfulamazing 0:03:05 1 418 2016-02-17 Favorite Share Remix 30 Our God is an Awesome God (Remix) carnage81 Newbie mercifulgodwonderfulawesomeholyall powerfulamazing 0:03:05 1 39 2019-02-15 Favorite Share Remix 31 Our God is an Awesome God (Remix) Phaze 999 Newbie all powerfulawesomemercifulholygodwonderfulamazing 0:03:05 1 20 2022-01-20 Favorite Share 32 woooooooooo stassey uncategorized 0:02:17 0 17 2011-06-14 Favorite Share Remix